rs12336255 chr9:130265876 G>A
- Sequence
gcacccgcagccagagccgcgctc[G/A]gcatgatgcccggggcgccgctcc
- ASB in cell types
- HEK293T (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293T (embryonic kidney) | -0.51 | 1.35 | 2.21 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Liver, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg