rs12344857 chr9:131591313 C>G
- Sequence
aaggagcgggggcgcgggtggact[C/G]aggacttcctaccccaggtggtgg
- ASB in cell types
- HeLa S3 (cervical adenocarcinoma) ascending aorta HeLa Kyoto (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa S3 (cervical adenocarcinoma) | -0.93 | 1.83 | 3.00 | |||
| ascending aorta | -1.39 | 1.19 | 1.33 | |||
| HeLa Kyoto (cervical adenocarcinoma) | 0.67 | -0.25 | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, acute lung injury following major trauma, birth weight, chronic kidney disease