rs12352425 chr9:22042087 G>A
- Sequence
aaggactagcccagcaggttctac[G/A]ggtgagatcactgctagctcattc
- ASB in cell types
- HCC70 (ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HCC70 (ductal breast carcinoma) | n/a | 2.71 | 3.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), mitral annular calcium, parkinsons disease, triglycerides