rs12353145 chr9:19464762 C>A
- Sequence
gagatgcgggcgtggggagcggag[C/A]ccgatgagtgtagtgtctggagcg
- ASB in cell types
- HCT-116-RAD21-mAC HCT-116 (colon carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HCT-116-RAD21-mAC | 2.03 | -1.86 | 1.33 | |||
| HCT-116 (colon carcinoma) | 1.03 | -0.38 | 1.17 |
Items per page:
1 – 2 of 2