rs12355893 chr10:110547414 T>G
- Sequence
aaccattcgcctttcctgctgatg[T/G]tgaacatggcccctttttttctga
- ASB in cell types
- hepatocytes foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| hepatocytes | 1.03 | -0.58 | 1.33 | |||
| foreskin keratinocyte | 0.22 | n/a | 2.50 |
Items per page:
1 – 2 of 2