rs12363518 chr11:128336738 C>G
- Sequence
tcctgaaacttgcaccccactgtc[C/G]tgtccatctcagtgaccccttcac
- ASB for transcription factors
- GATA3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA3_HUMAN | -1.20 | 1.54 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP mitral annular calcium, rheumatoid arthritis, systolic blood pressure (sbp), urinary albumin-to-creatinine ratio, waist hip ratio