rs12369529 chr12:70577145 C>T
- Sequence
caatttttttgtgatgaagttatt[C/T]attcctgggaagtaatagctaaca
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.25 | 0.66 | 2.02 | |||
| GM12878 (female B-cells) | 0.30 | 0.62 | 1.25 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.65 | -0.04 | 1.63 |
Items per page:
1 – 3 of 3