rs12372721 chr12:34022366 C>T
- Sequence
ttttgacactttgtgcgccccggg[C/T]aatgcgattgagagggtaatcatc
- ASB in cell types
- HEK293 (embryonic kidney) liver MCF7 (Invasive ductal breast carcinoma) HEK293T (embryonic kidney)
- ASB for transcription factors
- GABPA_HUMAN CTCF_HUMAN PKNX1_HUMAN GATA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GABPA_HUMAN | 1.89 | -1.84 | 1.40 | n/a | No Hit | |||
| CTCF_HUMAN | 0.76 | 0.48 | 1.46 | n/a | No Hit | |||
| PKNX1_HUMAN | 2.04 | -1.63 | 1.75 | n/a | No Hit | |||
| GATA1_HUMAN | 1.59 | -1.47 | 2.00 | n/a | No Hit | |||
| E4F1_HUMAN | 0.09 | 2.07 | 1.67 | n/a | n/a |
Items per page:
1 – 5 of 8
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cortex, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Stomach, Thyroid