rs1239181 chr17:38854245 A>C
- Sequence
tctatttattgacccgtccccccc[A/C]acacacactctttttttctttttt
- ASB in cell types
- HEK293 (embryonic kidney) GM12878 (female B-cells) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.66 | 0.66 | 1.69 | |||
| GM12878 (female B-cells) | -1.50 | 1.67 | 1.33 | |||
| HepG2 (hepatoblastoma) | 0.66 | -0.37 | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Lung, Nerve_Tibial, Pituitary, Prostate, Testis, Thyroid, Whole_Blood