rs12402811 chr1:195958396 A>C
- Sequence
ttttgccatttattattactcata[A/C]gtctagtctaagattgcctttgtc
- ASB for transcription factors
- P63_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| P63_HUMAN | 0.04 | 1.21 | 1.55 | n/a | No Hit |
Items per page:
1 – 1 of 1