rs12405456 chr1:178543196 T>G
- Sequence
gtggcttggcctcccctccagagc[T/G]tcgcatatcctggcgggagccggc
- ASB in cell types
- A549 (lung carcinoma) HEK293 (embryonic kidney) MCF7 (Invasive ductal breast carcinoma) liver
- ASB for transcription factors
- CTCF_HUMAN RAD21_HUMAN SMC3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.30 | 0.18 | 1.54 | n/a | No Hit | |||
| RAD21_HUMAN | 1.48 | -0.06 | 1.75 | n/a | n/a | |||
| SMC3_HUMAN | 1.32 | -0.31 | 1.81 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Liver, Muscle_Skeletal, Nerve_Tibial, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood