rs12406428 chr1:200307687 A>G
- Sequence
tatgctgccacctctcggccttat[A/G]aggaaatacatctcagggagagga
- ASB in cell types
- erythroid progenitors kidney
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid progenitors | 2.31 | -3.35 | 2.00 | |||
| kidney | 1.73 | n/a | 2.00 |
Items per page:
1 – 2 of 2