rs12407033 chr1:227313702 G>A
- Sequence
acagcatatgtgaagaacaaaagt[G/A]tcctagaaaagatacatatccatc
- ASB in cell types
- HEK293 (embryonic kidney) HEK293T (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.58 | 0.84 | 3.52 | |||
| HEK293T (embryonic kidney) | -0.29 | 0.86 | 2.05 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, college completion, diastolic blood pressure (dbp), ldl cholesterol, ldl cholesterol change with statins, systolic blood pressure (sbp), total cholesterol
GTEx eQTL Cells_Cultured_fibroblasts, Esophagus_Mucosa, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg