rs1240735 chr1:1471663 A>C
- Sequence
cccgccgccccggagcacgctcct[A/C]aattgcggcgccgtcgctatggcg
- ASB in cell types
- CUTLL1 (T-cell lymphoblastic lymphoma 1)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CUTLL1 (T-cell lymphoblastic lymphoma 1) | 1.93 | -0.64 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Skin_Sun_Exposed_Lower_leg