rs12409352 chr1:160030645 A>T
- Sequence
agccagccacatggcctgccctat[A/T]aaccataacattaggagaactaca
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.58 | -0.20 | 2.02 | |||
| K562 (myelogenous leukemia) | -0.25 | 0.44 | 2.13 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Brain_Cerebellum, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Esophagus_Mucosa, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood