rs1241489 chr14:25132786 G>A
- Sequence
gtgaatgttggaagagtcctgaac[G/A]gcatccctcgggggtgggcagcat
- ASB in cell types
- HepG2 (hepatoblastoma) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.85 | -0.05 | 1.69 | |||
| foreskin keratinocyte | -2.85 | 1.75 | 2.50 |
Items per page:
1 – 2 of 2