rs12417692 chr11:70196317 G>C
- Sequence
ggctgcctgcaggagctgcactca[G/C]ggaagggaaaggccccgcacctgg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) HEK293 (embryonic kidney) HEK293T (embryonic kidney) CD34+ hematopoietic stem cells
- ASB for transcription factors
- GATA3_HUMAN CREB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA3_HUMAN | 1.87 | -1.55 | 1.50 | n/a | No Hit | |||
| CREB1_HUMAN | 1.34 | -0.42 | 1.50 | n/a | No Hit |
Items per page:
1 – 2 of 2