rs12421078 chr11:8328934 G>T
- Sequence
gcccagggtgagcctgtgccagaa[G/T]cccaggtcctctagggggcggcag
- ASB in cell types
- K562 (myelogenous leukemia) foreskin keratinocyte HeLa S3 (cervical adenocarcinoma) epidermal keratinocytes
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.23 | 1.00 | 1.75 | n/a | No Hit |
Items per page:
1 – 1 of 1