rs12423664 chr12:132493308 G>A
- Sequence
tcttgagggctcttcctactctgg[G/A]atgctggaggatgggacgctcagg
- ASB in cell types
- PC3 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | n/a | 2.05 | 2.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI coronary artery disease and triglyceride levels (multivariate analysis), lipid traits (pleiotropy) (hipo component 2)
GRASP diastolic blood pressure (dbp), fasting blood glucose, ldl cholesterol, resistance to kuru in aged women despite likely exposure, systolic blood pressure (sbp), total cholesterol, triglycerides