rs1242993 chr12:124501972 C>T
- Sequence
cagttctgggatgtgcgcacaaga[C/T]gctgcggagcgccagctccacggg
- ASB in cell types
- MDA-MB-453 (breast adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDA-MB-453 (breast adenocarcinoma) | 1.04 | -0.84 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP homa-ir, ldl cholesterol, obesity with early age of onset (age >2), rheumatoid arthritis, total cholesterol