rs12433611 chr14:85187774 G>A
- Sequence
tctctaaggctctatttcatttca[G/A]aattgggtataataatagctactg
- ASB in cell types
- LHSAR (prostate epithelial cells)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 1.25 | -0.19 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP decrease in fev1 (in asthmatic participants >=30 years old), decrease in fev1 (in asthmatic participants), lung function, forced expiratory volume in 1 second (fev1) percent predicted (in asthmatic participants), obesity with early age of onset (age >2)