rs12435580 chr14:76976812 A>C
- Sequence
gagagccagtttcctggcctggca[A/C]atctgttgctagagcagttttctg
- ASB in cell types
- ICN12 (primary pre-B acute lymphomablastic leukemia)
- ASB for transcription factors
- TFE2_HUMAN PBX1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TFE2_HUMAN | -2.08 | 2.00 | 1.33 | 3.16 | Concordant | |||
| PBX1_HUMAN | -1.32 | 1.67 | 1.33 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Prostate