rs12440239 chr15:94770563 A>G
- Sequence
cacttaaagggtttcctatggttc[A/G]atcctggaagacttggctattatc
- ASB in cell types
- neural cell
- ASB for transcription factors
- EP300_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EP300_HUMAN | 1.94 | -1.72 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, autism, comorbid depressive syndrome and alcohol dependence, nausea in response to topiramate treatment in healthy volunteers