rs12441566 chr15:90158680 A>G
- Sequence
acacagcaaacacttattgagcac[A/G]tatggtagccaggcactgtggaaa
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.20 | 0.93 | 2.00 | |||
| HEK293 (embryonic kidney) | -0.33 | 0.68 | 1.78 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.61 | 0.49 | 1.41 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Esophagus_Mucosa, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood