rs12453548 chr17:33482508 G>A
- Sequence
ttcccagtaatatcccatattctc[G/A]agaagtcatttatcattcaaaaaa
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.47 | 0.91 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, cognitive response of healthy volunteers to topiramate treatment as measure by the digit span forward cognitive test, cognitive response of healthy volunteers to topiramate treatment as measure by the digit symbol cognitive test, diastolic blood pressure (dbp), hip bone mineral density (bmd), maternal transmission distortion