rs12454861 chr18:771286 G>C
- Sequence
gaagctgaggcatgagactcattt[G/C]aacctaggaggcggaggttgcagt
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.29 | 0.45 | 1.25 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Brain_Caudate_basal_ganglia, Brain_Hypothalamus, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Testis, Thyroid, Whole_Blood