rs12467280 chr2:35410674 C>T
- Sequence
gggatccttctgcgtgtattctga[C/T]cttgctttcttttctcataaagtt
- ASB in cell types
- kidney HepG2 (hepatoblastoma) epidermal keratinocytes HeLa S3 (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| kidney | 1.95 | n/a | 2.00 | |||
| HepG2 (hepatoblastoma) | -0.21 | 0.77 | 2.00 | |||
| epidermal keratinocytes | 1.58 | 0.73 | 2.00 | |||
| HeLa S3 (cervical adenocarcinoma) | 1.35 | -0.91 | 2.00 |
Items per page:
1 – 4 of 4