rs12467311 chr2:35410717 C>T
- Sequence
aaagttccatttttgcagagccca[C/T]atatttgtttctgaattaatatta
- ASB in cell types
- CD34+ stem cells-derived erythroblasts HeLa Kyoto (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CD34+ stem cells-derived erythroblasts | -1.91 | 2.14 | 2.00 | |||
| HeLa Kyoto (cervical adenocarcinoma) | 1.09 | -0.31 | 2.00 |
Items per page:
1 – 2 of 2