rs12470772 chr2:160918978 C>T
- Sequence
tgagagagaaattatcatgttttg[C/T]tctacagggaaaggattcgtgttg
- ASB in cell types
- A549 (lung carcinoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.59 | 0.45 | 1.52 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, height, kawasaki disease, kawasaki disease (excluding controls with chronic hepatitis b, drug eruption and tuberculosis), postoperative nausea and vomiting, years of education