rs12476527 chr2:26692756 G>T
- Sequence
gccccgggcgctgagcgggtgccc[G/T]gcgcggagagcggcgagcgcagcc
- ASB in cell types
- HCC1954 (ductal breast carcinoma) MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- NRF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NRF1_HUMAN | -2.21 | 1.98 | 1.50 | -2.01 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
