rs12476896 chr2:68714881 G>T
- Sequence
agtattttttattaaaatacggaa[G/T]gaaagaaaaatacaatgggttcag
- ASB in cell types
- GM12878 (female B-cells) periferal blood macrophages
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.26 | 0.15 | 1.90 | -3.82 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
