rs12479963 chr20:50461202 T>C
- Sequence
ctggaatggggatgatgttattta[T/C]gtcacagtttcgttgggaggatta
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) foreskin keratinocyte
- ASB for transcription factors
- CREB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CREB1_HUMAN | n/a | 2.13 | 4.50 | 6.79 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
