rs12480193 chr20:53922988 G>A
- Sequence
ttaaagcatagcacaatggatttc[G/A]tgttttgcaagggctgtttcagca
- ASB in cell types
- periferal blood macrophages GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| periferal blood macrophages | 1.57 | -0.39 | 2.00 | |||
| GM12878 (female B-cells) | 2.00 | -2.47 | 1.50 |
Items per page:
1 – 2 of 2