rs12483205 chr21:37368522 A>G
- Sequence
tgacacgaatcccataatctgggc[A/G]cagcgcaggaatgctagcaccatt
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- ATF3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ATF3_HUMAN | -2.05 | 2.11 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP eye color, homa-ir, replication of hiv-1 in monocyte-derived macrophages, replication of hiv-1 in monocyte-derived macrophages (disease progression), triglycerides
PheWAS abdominal pain, abnormal findings on examination of urine, acquired foot deformities, acquired toe deformities, acute cystitis, adverse effects of insulins and antidiabetic agents, altered mental status, ascvd, asthma with exacerbation, atherosclerosis, benign neoplasm of other parts of digestive system, bronchitis, cardiomyopathy, celiac disease, celiac or tropical sprue, chronic pain syndrome, congenital anomalies of peripheral vascular system, congenital musculoskeletal deformities of spine, congenital pigmentary anomalies of skin, derangement of joint, non-traumatic, dermatomyositis and polymyositis, disorders of coccyx, diverticulum of esophagus, acquired, dystrophy of female genital tract, essential hypertension, femoral hernia, fracture of neck of femur, gastric ulcer, hallux valgus (bunion), heart failure nos, hereditary and idiopathic peripheral neuropathy, hidradenitis, hx of malignant neoplasm of oral cavity and pharynx, hypercoagulable state, hyperglyceridemia, hypertension, infertility, male, intestinal malabsorption, intestinal malabsorption nos, intracranial hemorrhage (injury), keloid scar, keratitis, infectious, lyme disease, lymphadenitis, male infertility and abnormal spermatozoa, memory loss, mild cognitive impairment, mucous polyp of cervix, nephritis and nephropathy in diseases classified elsewhere, obstruction of bile duct, osteoarthrosis of multiple sites, other disorders of circulatory system, other forms of chronic heart disease, other nonmalignant breast conditions, other nonspecific findings on examination of urine, otitis media, pain in limb, peripheral or central vertigo, polyp of female genital organs, postlaminectomy syndrome, primary/intrinsic cardiomyopathies, psoriasis, psoriasis & related disorders, psoriasis vulgaris, respiratory failure, respiratory failure, insufficiency, arrest, retinal detachments and defects, retinal vascular changes and abnomalities, sensorineural hearing loss, spirochetal infection, subdural hemorrhage (injury), symptoms involving female genital tract, vaginitis and vulvovaginitis, viral warts & hpv
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Esophagus_Mucosa, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid