rs12485738 chr3:56831748 A>G
- Sequence
ctggtgtgtacgttcagaaaacat[A/G]atcaacattttaagaaaggtcaag
- ASB in cell types
- HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.10 | 0.69 | 1.31 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration, aortic valve calcium, mean corpuscular hemoglobin (mch) (pg), mean corpuscular hemoglobin concentration (mchc) (g/dl), mean platelet volume (mpv), mean platelet volume (mpv) (fl), log, mean red blood cell volume (fl), platelet aggregation in response to adp 3um/2um, platelet aggregation in response to adp ec50/2um, platelet aggregation in response to epinephrine ec50, platelet count (plt) (10^9/l)