rs12496181 chr3:187318848 T>C
- Sequence
ctgccattgataagtcacatgaca[T/C]attgattatacaatccttgagccc
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- HLF_HUMAN FOXA2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HLF_HUMAN | -2.62 | 2.12 | 1.50 | n/a | No Hit | |||
| FOXA2_HUMAN | -1.63 | 1.70 | 1.33 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP infant head circumference, irritible bowel syndrome, parkinsons disease, resistance to kuru in aged women despite likely exposure