rs1250003 chr10:79087057 C>T
- Sequence
tttttaacttcttagtgtgttaga[C/T]tagattttatctgcctttcctacc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- FOXA1_HUMAN GATA3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | 0.29 | 0.98 | 1.68 | n/a | No Hit | |||
| GATA3_HUMAN | -0.16 | 1.30 | 1.61 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, birth weight, breast cancer, infant head circumference, lp-pla2 activity, parkinsons disease