rs125034 chr1:54889436 A>G
- Sequence
ttgtggcatgcacttgtagtctca[A/G]ctactcaggaggttgaggtgggag
- ASB for transcription factors
- SOX13_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SOX13_HUMAN | n/a | 1.72 | 1.33 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cortex, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Muscle_Skeletal, Nerve_Tibial, Testis