rs12503440 chr4:126846067 T>C
- Sequence
ctatgtttatctacaagatgtata[T/C]tgtttactctttaatttataagca
- ASB in cell types
- LNCaP (prostate carcinoma)
- ASB for transcription factors
- FOXA1_HUMAN ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | -0.51 | 1.42 | 1.45 | n/a | No Hit | |||
| ANDR_HUMAN | -0.90 | 1.74 | 1.50 | -0.59 | Weak Discordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), sporadic creutzfeldt-jakob disease, tetrology of fallot, total cholesterol