rs12508066 chr4:91064628 C>G
- Sequence
cacaatcatagaaattccagactc[C/G]cagaaggaaagcagctgtttacta
- ASB in cell types
- VCaP (prostate carcinoma) cranial neural crest cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| VCaP (prostate carcinoma) | -1.51 | 1.55 | 2.83 | |||
| cranial neural crest cells | 1.48 | n/a | 2.00 |
Items per page:
1 – 2 of 2