rs12512134 chr4:113816000 G>A
- Sequence
ccaaagttatttccaatgagtctt[G/A]taagaaagggaggaagtgatctga
- ASB in cell types
- periferal blood macrophages CD14+ monocytes monocyte-derived macrophages
- ASB for transcription factors
- SPI1_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 3.14 | 2.20 | 2.08 | n/a | No Hit | |||
| STAT1_HUMAN | 1.69 | n/a | 2.50 | 2.93 | Discordant |
Items per page:
1 – 2 of 2
Motif analysis
