rs12514672 chr5:35188155 C>T
- Sequence
ggaacttgctaggaagaaactagc[C/T]gtgcctggaaagtcgggcttttcg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) breast tumor tissue
- ASB for transcription factors
- FOXA1_HUMAN PRGR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | 1.38 | -0.50 | 2.83 | n/a | No Hit | |||
| PRGR_HUMAN | 1.54 | -0.97 | 2.33 | 1.91 | Weak Discordant |
Items per page:
1 – 2 of 2
Motif analysis
