rs12517169 chr5:142107965 A>G
- Sequence
tcgggaaagcctttagcatggcca[A/G]acccttcaagttttgacttcatgt
- ASB in cell types
- K562 (myelogenous leukemia) CD34+ hematopoietic stem cells-derived proerythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.65 | -0.08 | 1.99 | |||
| CD34+ hematopoietic stem cells-derived proerythroblasts | 1.40 | 0.02 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Cortex, Brain_Nucleus_accumbens_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Lung, Muscle_Skeletal, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood