rs12533033 chr7:129843962 T>G
- Sequence
atcacagacaacgtgttataaaac[T/G]aggagtttagcgtgtcccagaaag
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.74 | 0.14 | 1.51 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, cystatin c in serum, diabetic retinopathy in type 2 diabetes mellitus, ldl cholesterol change with statins, obesity with early age of onset (age >2), serum creatinine, total cholesterol change with statins