rs12534221 chr7:131603231 C>A
- Sequence
cagtggcacactcattcacccaag[C/A]aagcagagggctgtagggagcttg
- ASB in cell types
- CD34+ hematopoietic stem cells-derived proerythroblasts
- ASB for transcription factors
- GATA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA1_HUMAN | 1.95 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, barnes akathisia rating scale, beta-amyloid peptide (abeta1-42) in cerebrospinal fliud in controls, triglycerides change with statins, urinary albumin-to-creatinine ratio
PheWAS abnormal coagulation profile, abnormal kidney function, abnormal loss of weight and underweight, abnormal papanicolaou smear of cervix and cervical hpv, abnormal weight gain, acute reaction to stress, acute, but ill-defined cerebrovascular disease, behcets syndrome, bursitis, calcaneal spur, exostosis nos, cancer of larynx, cancer of the upper aerodigestive tract, cataract, chorioretinal scars, chronic tonsillitis and adenoiditis, colon cancer, colorectal cancer, congenital musculoskeletal anomalies, contracture of joint, disorders of choroid, duodenitis, dyschromia and vitiligo, effects of radiation nos, first degree av block, gastritis and duodenitis, generalized hyperhidrosis, h. pylori, heart transplant/surgery, hemorrhage from gastrointestinal ulcer, hepatomegaly, hx of malignant neoplasm of oral cavity and pharynx, hypertensive heart and/or renal disease, infections of kidney, iron deficiency anemias, iron deficiency anemias nos, iron metabolism disorder, labyrinthitis, lung disease due to external agents, malignant neoplasm of renal pelvis, megaloblastic anemia, osteopenia, other disorders of stomach and duodenum, other pulmonary inflamation or edema, other specified gastritis, other symptoms involving abdomen and pelvis, periostitis, pernicious anemia, pernicious or b12 deficiency anemia, phlebitis and thrombophlebitis of lower extremities, pneumoconiosis, polycythemia vera, protein-calorie malnutrition, respiratory failure, insufficiency, arrest, reticulosarcoma, rhabdomyolysis, rosacea, scar conditions and fibrosis of skin, secondary malignancy of bone, spondylosis without myelopathy, synoviopathy, testicular dysfunction, torticollis, unstable angina (intermediate coronary syndrome)