rs12535722 chr7:129832216 C>T
- Sequence
gctcctactcccacctctcccagg[C/T]gcagggagaggacaaaaagcataa
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.52 | 0.24 | 1.52 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, cystatin c in serum, diabetic retinopathy in type 2 diabetes mellitus, ldl cholesterol change with statins, obesity with early age of onset (age >2), paternal transmission distortion, psoriasis and/or psoriatic arthritis, psoriasis only (no arthritis), psoriatic arthritis, serum creatinine, total cholesterol change with statins