rs1253629 chr1:236452219 G>A
- Sequence
gccctcatcacttggcttggatgg[G/A]gcagagagcagccctgtttctcct
- ASB in cell types
- MCF10A (breast epithelial cells) CD34+ hematopoietic stem cells-derived proerythroblasts
- ASB for transcription factors
- GATA1_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA1_HUMAN | 1.72 | -1.22 | 1.83 | n/a | No Hit | |||
| CTCF_HUMAN | 0.31 | 0.84 | 1.47 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, ldl cholesterol, obesity with early age of onset (age >2), total cholesterol, transmission distortion