rs12542151 chr8:141431608 G>C
- Sequence
ggctgctgtctggatcctgggctg[G/C]tgcccaggatggggctcccgcgtg
- ASB in cell types
- BCBL-1 (B-cell lymphoma) GM12878 (female B-cells) neutrophils
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| BCBL-1 (B-cell lymphoma) | n/a | 2.25 | 3.00 | |||
| GM12878 (female B-cells) | 0.53 | 0.43 | 1.28 | |||
| neutrophils | 0.01 | 1.80 | 1.50 |
Items per page:
1 – 3 of 3