rs12549429 chr8:28060851 T>C
- Sequence
agactgtggaggacctctcgggca[T/C]tgggctggcctctgcatcctgtaa
- ASB in cell types
- HEK293 (embryonic kidney) LNCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.00 | 0.54 | 1.86 | |||
| LNCaP (prostate carcinoma) | -0.87 | 1.25 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, refractive error, rheumatoid arthritis, schizophrenia, spine bone mineral density (bmd), waist hip ratio