rs12564683 chr1:224922664 A>G
- Sequence
caggctctgccaaaatggcctcac[A/G]cctatactgctaactccaggttat
- ASB in cell types
- HEK293 (embryonic kidney) HEK293T (embryonic kidney) esophagus squamous epithelium foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.51 | 1.22 | 3.64 | |||
| HEK293T (embryonic kidney) | -0.18 | 1.19 | 2.08 | |||
| esophagus squamous epithelium | 0.21 | 1.76 | 1.22 | |||
| foreskin keratinocyte | 0.48 | n/a | 2.83 |
Items per page:
1 – 4 of 4